SenNet Whole Genome Sequencing (WGS)

Last Updated 6/23/2020

Overview

This document details bulk whole genome sequencing assays, data states, metadata fields, file structure, QA/QC thresholds, and data processing.

Description

Whole genome sequencing (WGS) measures the genome-wide nucleotide sequence in a biological sample. Generally, the purpose is to screen the entire genome for all sequence variations (against a reference sequence) such as benign sequence variants (SNPs) or candidate pathogenic mutations. Examples of sequence variants include chromosomal rearrangements, nucleotide substitutions, deletions or insertions. An example use case would be a genome-wide search for somatic mutations (cancer-causing mutations that arose in a somatic cell, as opposed to a germline cell) by comparing DNA sequence in a patient’s tumor cells to that in the same patient’s healthy cells. See Appendix 1, below, for more detailed description.

SenNet Whole Genome Sequencing Data States (Levels)

The SenNet project provides data to the public in a variety of data states, which denote the amount of processing that has been done to the data. The data states for WGS seq data provided by the SenNet project are listed below:

Data State Description Example File Type
0 Raw data: This is the raw sequence data (unprocessed) generated directly by the sequence instrument in files either with Phred quality scores (fastq). FASTQ
1 Aligned data: SAM files contain sequence data that has been aligned to a reference genome and includes chromosome coordinates. BAM files are compressed binary versions of SAM files SAM, BAM
2 Mutations: Variant call format (VCF). .vcf

SenNet Metadata:

All SenNet data will have searchable metadata fields. The metadata schema is available in Github for download.

Values to be produced by HIVE Pipeline

Level Field Definition Valid Values Purpose
na data_analysis_protocols_io_doi Link to the protocol document describing how the HIVE or TMC is processing the data    
na reference_genome Genome used for alignment GRCh38 or GRCh37  
na mapping_platform Software used for quantification BWA-MEM  
na mapping_version Version of BWA-MEM used, with SenNet-specific modifications    
na number_of_raw_reads Raw number of sequencing reads Numeric Value  
na quality_score Average phred score of dataset Numeric Value  
na percent_unique_mapped_reads When a set of reads are aligned with a genome, some will map in multiple locations. This indicates the percentage of reads that mapped to only one location on the genome [0-1] QA/QC

SenNet WGS Sequence Raw File Structure

The raw sequencing data is recorded in a FASTQ file which contains sequenced reads and corresponding sequencing quality information. Every read in FASTQ format is stored in four lines as follows

@HWI-ST1276:71:C1162ACXX:1:1101:1208:2458 1:N:0:CGATGT

NAAGAACACGTTCGGTCACCTCAGCACACTTGTGAATGTCATGGGATCCAT

+

#55???BBBBB?BA@DEEFFCFFHHFFCFFHHHHHHHFAE0ECFFD/AEHH

Line 1 begins with a ‘@’ character and is followed by a sequence identifier and an optional description (such as a FASTA title line). Line 2 is the sequence of the read. Line 3 begins with a ‘+’ character and is optionally followed by the same sequence identifier (and any description) again. Line 4 encodes the quality values for the bases in Line 2.

SenNet QA/QC of raw (state0) data files

The bolded steps below constitute a series of standard RNA-seq data analysis workflow.

Pre-alignment QC with FastQC

wgs Figure 1: Plot of per sequence base quality ((Figure from Babraham Bioinoformatics)

qc_metric Threshold Method
average_base_quality_scores >20 (accuracy rate 99%) FastQC
gc_content   FastQC
sequence_length_distribution >45 (encode) FastQC
sequence_duplication   FastQC
k-mer_overrepresentation 20 (accuracy rate 99%)  
contamination_of_primers_and_adapters_in_sequencing_data   Library specific data on adapters need to be provided to the read-trimming tool like trimmomatic (Bioinformatics. 2014 Aug 1; 30(15):2114-20.).

Terms defined in this document

Base quality scores: prediction of the probability of an error in base calling GC content: Percentage of bases that are either guanine (G) or cytosine (C) K-mer overrepresentation: Overrepresented k-mer sequences in a sequencing library

Library-level Alignment QC: Note that this is not per-cell. Trimmed reads are mapped to reference genome.

qc_metric Threshold Method
unique_mapping_percent Ideally > 95% (Encode) Acceptable > 80% (at least for bulk) SAMtools/Picard
duplicate_reads_percent   SAMtools/Picard
fragment_length_distribution >45 (encode) SAMtools/Picard
gc_bias Biased if variance of GC content is larger than 95% of confidence threshold of the baseline variance SAMtools/Picard
library_complexity NRF>0.9, PBC1>0.9, and PBC2>3 https://www.encodeproject.org/data-standards/terms/#library

Uniquely mapping % – Percentage of reads that map to exactly one location within the reference genome.

Duplicated reads % - Percentage of reads that map to the same genomic position and have the same unique molecular identifier (Encode)

Post-alignment processing QC: (see Per cell QC metrics table below)

Appendix 1. Brief detailed description of WGS protocol

New England Biosciences (NEB) whole genome sequencing library preparation kit is outlined below. A total amount of 1.0μg DNA per sample was used as input material for the DNA sample preparations. Sequencing libraries were generated using NEBNext® DNA Library Prep Kit following manufacturer’s recommendations and indices were added to each sample. The genomic DNA is randomly fragmented to a size of 350bp by shearing, then DNA fragments were end polished, A-tailed, and ligated with the NEBNext adapter for Illumina sequencing, and further PCR enriched by P5 and indexed P7 oligos. The PCR products were purified (AMPure XP system) and resulted libraries were analyzed for size distribution by Agilent 2100 Bioanalyzer and quantified using real-time PCR. See the detailed protocol here: dx.doi.org/10.17504/protocols.io.bfsmjnc6

This protocol adheres to the MINSEQE standards put forward by the Functional Genomics Data Society (FGED).

For Additional Help

Please contact: Aaron Horning